Skip to main content

Table 1 Primer sets used for qPCR

From: MicroRNA-210 downregulates TET2 and contributes to inflammatory response in neonatal hypoxic-ischemic brain injury

  Forward primer (5′-3′) Backward primer (5′-3′)
TNF-α CAGCCGATGGGTTGTACCTT GGCAGCCTTGTCCCTTGA
IL-6 CCACGGCCTTCCCTACTTC TGGGAGTGGTATCCTCTGTGAA
IL-1β GAGTGTGGATCCCAAGCAAT TACCAGTTGGGGAACTCTGC
IFN-γ TGCTGATGGGAGGAGATGTCT TGCTGTCTGGCCTGCTGTTA
CCL2 AGGTGTCCCAAAGAAGCTGTAG AATGTATGTCTGGACCCATTCC
CCL3 TGGAACTGAATGCCTGAGAGT TAGGAGATGGAGCTATGCAGGT
GAPDH CGACAGTCAGCCGCATCTT CCAATACGACCAAATCCGTTG
IL-1β ChIP TCCCTGGAAATCAAGGGGTGG TCTGGGTGTGCATCTACGTGCC