Skip to main content

Table 1 Primers used for genotyping

From: The CD200R1 microglial inhibitory receptor as a therapeutic target in the MPTP model of Parkinson’s disease

Genotype Forward 5′ ➔ 3′ Reverse 5′ ➔ 3′ Amplicon
CD200 +/+ mCD200-Fw
GAAGACAAACCTAGCGGAGACATTAC
mCD200-Rv
CTCTTCAGCAATATCACGGGTAGC
506 bp
CD200 −/− mNEO-Fw
GGGAGTGGAACTGTAGAAGGGTG
mNEO-Rv
AGGCTATTCGGCTATGACTGGG
596 bp