Skip to main content

Table 1 Primers for qRT-PCR

From: NAD+ improves cognitive function and reduces neuroinflammation by ameliorating mitochondrial damage and decreasing ROS production in chronic cerebral hypoperfusion models through Sirt1/PGC-1α pathway

Gene Sense (5′-3′) Anti-sense (5′-3′)
r-IL-1β TGACCTGTTCTTTGAGGCTGAC CATCATCCCACGAGTCACAGAG
r-IL-6 CAGCGATGATGCACTGTCAGA GGAGAGCATTGGAAGTTGGGG
r-TNF-α GCCACCACGCTCTTCTGTCTA CGCTTGGTGGTTTGCTACGA
r-iNOS CAGATCCCGAAACGCTACACT TGAGTTGAACAAGGAGGGTGGT
r-COX-2 TCAGCCATGCAGCAAATCCTT TCCAGTCCGGGTACAGTCACA
r-Actin CGTTGACATCCGTAAAGACCTC TAGGAGCCAGGGCAGTAATCT
m-IL-1β TTTGAAGTTGACGGACCCCAA CACAGCTTCTCCACAGCCACA
m-IL-6 TTCTTGGGACTGATGCTGGTG CACAACTCTTTTCTCATTTCCACA
m-TNF-α ATGTCTCAGCCTCTTCTCATTC GCTTGTCACTCGAATTTTGAGA
m-iNOS GGGCTGTCACGGAGATCAATG GCCCGGTACTCATTCTGCATG
m-COX-2 GGGCCATGGAGTGGACTTAAA TGCAGGTTCTCAGGGATGTG
m-Actin CTGAGAGGGAAATCGTGCGT CCACAGGATTCCATACCCAAGA
  1. r rat, m mouse