Skip to main content

Table 1 Target sequences used to design custom CodeSet for nCounter assay

From: Complex molecular and functional outcomes of single versus sequential cytokine stimulation of rat microglia

Gene Gene accession # Target sequence
Aif1 (Iba1) NM_017196.2 ATCGATATTATGTCCTTGAAGCGAATGCTGGAGAAACTTGGGGTTCCCAAGACCCATCTAGAGCTGAAGAAATTAATTAGAGAGGTGTCCAGTGGCTCCG
Ccl22 NM_057203.1 TACATCCGTCACCCTCTGCCACCACGTTTCGTGAAGGAGTTCTACTGGACCTCAAAGTCCTGCCGCAAGCCTGGCGTCGTTTTGATAACCATCAAGAACC
Cd11b (Itgam) NM_012711.1 CATCCCTTCCTTCAACAGTAAAGAAATATTCAACGTCACCCTCCAGGGCAATCTGCTATTTGACTGGTACATCGAGACTTCTCATGACCACCTCCTGCTT
Cd68 (ED1) NM_001031638.1 CTCTCATTCCCTTACGGACAGCTTACCTTTGGATTCAAACAGGACCGACATCAGAGCCACAGTACAGTCTACCTTAACTACATGGCAGTGGAATACAATG
Cd163 NM_001107887.1 CCTCTGTAATTTGCTCAGGAAACCAATCGCATACACTGTTGCCATGTAGTTCATCATCTTCGGTCCAAACAACAAGTTCTACCATTGCAAAGGACAGTGA
C1r XM_001061611.1 ACAAAGACCTTATGGGTTATGTCAGCGGCTTCGGGATAACAGAAGATAAAATAGCTTTTAATCTCAGGTTTGTCCGTCTGCCCATAGCCGATCGAGAGGC
Cybb (Nox2) NM_023965.1 CAGTACCAAAGTTTGCCGGAAACCCTCCTATGACTTGGAAATGGATCGTGGGTCCCATGTTCCTGTATCTGTGTGAGAGGCTGGTGCGGTTTTGGCGATC
Ptgs2 (COX-2) NM_017232.3 TTCGGAGGAGAAGTGGGTTTTAGGATCATCAACACTGCCTCAATTCAGTCTCTCATCTGCAATAATGTGAAAGGGTGTCCCTTTGCCTCTTTCAATGTGC
Cx3cr1 NM_133534.1 ATGTGCAAGCTCACGACTGCTTTCTTCTTCATTGGCTTCTTTGGGGGCATATTCTTCATCACCGTCATCAGCATCGACCGGTACCTCGCCATCGTCCTGG
FcγR1a NM_001100836.1 TGATGGATCATACTGGTGCGAGGTAGCCACGGAGGACGGCCGTGTCCTTAAGCGCAGCACCAAGTTGGAGCTATTTGGTCCCCAGTCATCAGATCCTGTC
FcγR2b NM_175756.1 CTGGTCCAAGGAATGCTGTAGATATGAAAGAAAACATCTAGAGTCCCTTCTGTGAGTCCTGAAACCAACAGACACTACGATATTGGTTCCCAATGGTTGA
FcγR3a NM_207603.1 GACTCTTGTTTGCAATAGACACAGTGCTGTATTTCTCGGTGCAGAGGAGTCTTCAAAGTTCCGTGGCAGTCTATGAGGAACCCAAACTTCACTGGAGCAA
Gusb NM_017015.2 TCATTTGATCCTGGATGAGAAACGAAAAGAATATGTCATCGGAGAGCTCATCTGGAATTTTGCTGACTTCATGACGAACCAGTCACCACTGAGAGTAACA
Havcr2 (TIM-3) NM_001100762.1 CGATGAAATTAAGGACTCTGGAGAAACTATCAGAACTGCTGTCCACATTGGAGTAGGCGTCTCTGCTGGGCTGGCCCTGGCACTTATTCTTGGTGTTTTA
Hprt1 NM_012583.2 AGCTTCCTCCTCAGACCGCTTTTCCCGCGAGCCGACCGGTTCTGTCATGTCGACCCTCAGTCCCAGCGTCGTGATTAGTGATGATGAACCAGGTTATGAC
Hvcn1 (Hv1) XM_006249369.2 ACCAAGAGGATGAGCAGGTTCTTGAAGCACTTCACAGTGGTGGGGGACGACTACCACACCTGGAATGTCAACTACAAGAAGTGGGAGAACGAGGAGGATG
Il6 NM_012589.1 GGAACAGCTATGAAGTTTCTCTCCGCAAGAGACTTCCAGCCAGTTGCCTTCTTGGGACTGATGTTGTTGACAGCCACTGCCTTCCCTACTTCACAAGTCC
Kcna3 (Kv1.3) NM_019270.3 GCCACCTTCTCCAGAAATATCATGAACCTGATAGACATTGTAGCCATCATCCCTTATTTTATTACTCTGGGCACTGAGCTGGCTGAGCGACAGGGTAATG
Kcnj2 (Kir2.1) NM_017296.1 GTTCTTTGGCTGTGTGTTTTGGTTGATAGCTCTGCTCCACGGGGATCTGGATGCTTCTAAAGAGAGCAAAGCGTGTGTGTCTGAGGTCAACAGCTTCACG
Kcnn4 (KCa3.1) NM_023021.2 TACGTCTCTACCTGGTGCCTCGCGCGGTACTTCTGCGTAGCGGGGTCCTGCTCAACGCGTCTTACCGCAGCATCGGGGCGCTCAACCAAGTCCGATTCCG
Mrc1 NM_001106123.1 CTTTGGAATCAAGGGCACAGAGCTATATTTTAACTATGGCAACAGGCAAGAAAAGAATATCAAGCTTTACAAAGGTTCCGGTTTGTGGAGCAGATGGAAG
Msr1 (SR-A) NM_001191939.1 CACGTTCCATGACAGCATCCCTTCCTCACAACACTATAAATGGCTCCTCCGTTCAGGAGAAACTGAAGTCCTTCAAAGTTGCCCTCGTCGCTCTCTACCT
Myc NM_012603.2 ACCGAGGAAAACGACAAGAGGCGGACACACAACGTCTTGGAACGTCAGAGGAGAAACGAGCTGAAGCGTAGCTTTTTTGCCCTGCGCGACCAGATCCCTG
Ncf1 NM_053734.2 TCCATTCCCAGCATCCCATAATTGGGCTTGTCCGTGTTCCAACATCTGGGCGGAATTTCACAGCCAAAGGTCAAGAGGACTGCTGTTACGTTCAAGGTCG
Nos2 (iNOS) NM_012611.2 ACGGGACACAGTGTCGCTGGTTTGAAACTTCTCAGCCACCTTGGTGAGGGGACTGGACTTTTAGAGACGCTTCTGAGGTTCCTCAGGCTTGGGTCTTGTT
Nox1 NM_053683.1 CCGAGAAAGAAGATTCTTGGCTAAATCCCATCCAGTCTCCAAACGTGACAGTGATGTATGCAGCATTTACCAGTATTGCTGGCCTTACTGGAGTGGTCGC
Nox4 NM_053524.1 TGTTGGACAAAAGCAAGACTCTACATATCACCTGTGGCATAACTATTTGTATTTTCTCAGGTGTGCATGTAGCTGCCCACTTGGTGAACGCCCTGAACTT
P2ry6 NM_057124.2 TGGCCCAACATGCCTGGCCCTCCAAAATTTCTATGTCAACCACAAAACTAAGACACCTGTGTTTCGGGGACTGGTCAGTTCATGCTTGTTATACCAGAAT
Orai1 NM_001013982.1 GCCTTCTCCACCGTCATCGGGACGCTGCTTTTCCTGGCCGAAGTCGTGCTGCTCTGCTGGGTGAAGTTCTTACCGCTCAAGAGGCAGGCGGGACAGCCAA
Orai3 NM_001014024.1 ACCTGTAATGTGCTTTACAGTTGGCATCCTGGGAGAGATTTTACATAGGCTCCTCAGATGAACCACTTTACACTTGGTGACTTGTGGTGGTGTGTCCCAC
Rpl32 NM_013226.2 CATCGTAGAAAGAGCAGCACAGCTGGCCATCAGAGTCACCAATCCCAACGCCAGGCTACGCAGCGAAGAGAATGAATAGATGGCTTGTGTGCCTGTTTTG
Sirpa NM_013016.2 AGGACATTCATTCTCGGGTCATCTGCGAGGTAGCCCACGTCACCTTGGAAGGACGCCCGCTTAATGGGACCGCTAACTTTTCTAACATCATCCGAGTTTC
Stim1 NM_001108496.2 TATCTATCGTGATTGGTGTGGGTGGCTGCTGGTTTGCCTATATCCAGAACCGTTACTCTAAGGAGCACATGAAGAAAATGATGAAGGATCTGGAAGGATT
Stim2 NM_001105750.2 TTCACAATTGGACGCTTGAGGATACCCTGCAGTGGTTGATAGAATTTGTTGAACTCCCACAATACGAGAAGAATTTTAGGGATAATAATGTGAAAGGAAC
Tnfa NM_012675.2 GGTGATCGGTCCCAACAAGGAGGAGAAGTTCCCAAATGGGCTCCCTCTCATCAGTTCCATGGCCCAGACCCTCACACTCAGATCATCTTCTCAAAACTCG
Trem2 NM_001106884.1 TCCGGCTGGCTGAGGAAGGGTGCCATGGAACCTCTCCACGTGTTTGTCCTGTTGCTGGTCACAGAGCTGTCCCAAGCCCTCAACACCACAGTGCTGCAGG