Skip to main content
Download PDF

Correction to: Cathepsin C promotes microglia M1 polarization and aggravates neuroinflammation via activation of Ca2+-dependent PKC/p38MAPK/NF-κB pathway

Journal of Neuroinflammation volume 19, Article number: 14 (2022) Cite this article

The Original Article was published on 16 January 2019

Correction to: Journal of Neuroinflammation (2019) 16:10 https://doi.org/10.1186/s12974-019-1398-3

The original version of this article [1] unfortunately contained a mistake.

In recent research work, the mistake occurred on primer sequence of NR2B for RT-PCR shown in Table 1 (Material and method).

The corrected primer sequence of NR2B should be as followings

Forward: GCTCATCGCCAAGGGTACATC

Reverse: TGCACTATTTCAAGTCACATGCCTA

The correct version of Table 1 is given here.

Table 1 Primer sequences used for RT-PCR analysis
Full size table

Reference

  1. Liu Q, Zhang Y, Liu S, Liu Y, Yang X, Liu G, Shimizu T, Ikenaka K, Fan K, Ma J. Cathepsin C promotes microglia M1 polarization and aggravates neuroinflammation via activation of Ca 2+-dependent PKC/p38MAPK/NF-κB pathway. J Neuroinflam. 2019;16:10. https://doi.org/10.1186/s12974-019-1398-3.

    Article  Google Scholar 

Download references

Author information

Author notes

  1. Qing Liu and Yanli Zhang contributed equally to this work

Authors and Affiliations

  1. Department of Anatomy, Dalian Medical University, West Section No.9, South Road, Lvshun, Liaoning, 116044, Dalian, China

    Qing Liu, Yanli Zhang, Shuang Liu, Yanna Liu, Kai Fan & Jianmei Ma

  2. Liaoning Provincial Key Laboratory of Brain Diseases, Dalian Medical University, Liaoning, 116044, Dalian, China

    Xiaohan Yang

  3. Basic Medicine College, Dalian Medical University, Liaoning, 116044, Dalian, China

    Gang Liu

  4. Wolfson Institute for Biomedical Research, University College London, London, UK

    Takahiro Shimizu

  5. Division of Neurobiology and Bioinformatics, National Institute for Physiological Sciences, Okazaki, Aichi, 444-8787, Japan

    Kazuhiro Ikenaka

  6. The National and Local Joint Engineering Research Center for Drug Development of Neurodegenerative Disease, Dalian Medical University, Dalian, 116044, Liaoning, China

    Jianmei Ma

Authors
  1. Qing Liu
    View author publications

    You can also search for this author in PubMed Google Scholar

  2. Yanli Zhang
    View author publications

    You can also search for this author in PubMed Google Scholar

  3. Shuang Liu
    View author publications

    You can also search for this author in PubMed Google Scholar

  4. Yanna Liu
    View author publications

    You can also search for this author in PubMed Google Scholar

  5. Xiaohan Yang
    View author publications

    You can also search for this author in PubMed Google Scholar

  6. Gang Liu
    View author publications

    You can also search for this author in PubMed Google Scholar

  7. Takahiro Shimizu
    View author publications

    You can also search for this author in PubMed Google Scholar

  8. Kazuhiro Ikenaka
    View author publications

    You can also search for this author in PubMed Google Scholar

  9. Kai Fan
    View author publications

    You can also search for this author in PubMed Google Scholar

  10. Jianmei Ma
    View author publications

    You can also search for this author in PubMed Google Scholar

Corresponding authors

Correspondence to Kai Fan or Jianmei Ma.

Additional information

Publisher's Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated in a credit line to the data.

Reprints and permissions

About this article

Check for updates. Verify currency and authenticity via CrossMark

Cite this article

Liu, Q., Zhang, Y., Liu, S. et al. Correction to: Cathepsin C promotes microglia M1 polarization and aggravates neuroinflammation via activation of Ca2+-dependent PKC/p38MAPK/NF-κB pathway. J Neuroinflammation 19, 14 (2022). https://doi.org/10.1186/s12974-021-02346-1

Download citation

  • Published:

  • DOI: https://doi.org/10.1186/s12974-021-02346-1

Journal of Neuroinflammation

ISSN: 1742-2094