Skip to main content

Correction to: Cathepsin C promotes microglia M1 polarization and aggravates neuroinflammation via activation of Ca2+-dependent PKC/p38MAPK/NF-κB pathway

The Original Article was published on 16 January 2019

Correction to: Journal of Neuroinflammation (2019) 16:10 https://doi.org/10.1186/s12974-019-1398-3

The original version of this article [1] unfortunately contained a mistake.

In recent research work, the mistake occurred on primer sequence of NR2B for RT-PCR shown in Table 1 (Material and method).

The corrected primer sequence of NR2B should be as followings

Forward: GCTCATCGCCAAGGGTACATC

Reverse: TGCACTATTTCAAGTCACATGCCTA

The correct version of Table 1 is given here.

Table 1 Primer sequences used for RT-PCR analysis

Reference

  1. 1.

    Liu Q, Zhang Y, Liu S, Liu Y, Yang X, Liu G, Shimizu T, Ikenaka K, Fan K, Ma J. Cathepsin C promotes microglia M1 polarization and aggravates neuroinflammation via activation of Ca 2+-dependent PKC/p38MAPK/NF-κB pathway. J Neuroinflam. 2019;16:10. https://doi.org/10.1186/s12974-019-1398-3.

    Article  Google Scholar 

Download references

Author information

Affiliations

Authors

Corresponding authors

Correspondence to Kai Fan or Jianmei Ma.

Additional information

Publisher's Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated in a credit line to the data.

Reprints and Permissions

About this article

Verify currency and authenticity via CrossMark

Cite this article

Liu, Q., Zhang, Y., Liu, S. et al. Correction to: Cathepsin C promotes microglia M1 polarization and aggravates neuroinflammation via activation of Ca2+-dependent PKC/p38MAPK/NF-κB pathway. J Neuroinflammation 19, 14 (2022). https://doi.org/10.1186/s12974-021-02346-1

Download citation

  • Published:

  • DOI: https://doi.org/10.1186/s12974-021-02346-1