- Correction
- Open access
- Published:
Correction to: Cathepsin C promotes microglia M1 polarization and aggravates neuroinflammation via activation of Ca2+-dependent PKC/p38MAPK/NF-κB pathway
Journal of Neuroinflammation volume 19, Article number: 14 (2022)
Correction to: Journal of Neuroinflammation (2019) 16:10 https://doi.org/10.1186/s12974-019-1398-3
The original version of this article [1] unfortunately contained a mistake.
In recent research work, the mistake occurred on primer sequence of NR2B for RT-PCR shown in Table 1 (Material and method).
The corrected primer sequence of NR2B should be as followings
Forward: GCTCATCGCCAAGGGTACATC
Reverse: TGCACTATTTCAAGTCACATGCCTA
The correct version of Table 1 is given here.
Reference
Liu Q, Zhang Y, Liu S, Liu Y, Yang X, Liu G, Shimizu T, Ikenaka K, Fan K, Ma J. Cathepsin C promotes microglia M1 polarization and aggravates neuroinflammation via activation of Ca 2+-dependent PKC/p38MAPK/NF-κB pathway. J Neuroinflam. 2019;16:10. https://doi.org/10.1186/s12974-019-1398-3.
Author information
Authors and Affiliations
Corresponding authors
Additional information
Publisher's Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Rights and permissions
Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated in a credit line to the data.
About this article
Cite this article
Liu, Q., Zhang, Y., Liu, S. et al. Correction to: Cathepsin C promotes microglia M1 polarization and aggravates neuroinflammation via activation of Ca2+-dependent PKC/p38MAPK/NF-κB pathway. J Neuroinflammation 19, 14 (2022). https://doi.org/10.1186/s12974-021-02346-1
Published:
DOI: https://doi.org/10.1186/s12974-021-02346-1